COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ8825

    Species Name: pharaonis
    Species Code: MONO003
    Specimen AccNo: MJ8825
    Locality: Kaiangabip
    Elevation: 180-280
    Date: 16. 3. 2008
    Method: WE
    Habitat: primary lowland forest - photo
    Collector: Janda&Ibalim
    Nest: undefined

    DNA

    Sequence COI-5P

    Process ID: GBAP5731-15
    Sequence ID: 7709492
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession: KM201400
    Nucleotides:
    GCGGGCATAGTGGGCACAGCCCTAAGTCTTCTAATCCGGGCCGAACTAAGTCAACCAGGG
    GCCCTCCTTGGAGACGATCAAATCTACAACGTCATTGTTACTGCTCATGCTTTTGTAATA
    ATCTTCTTCATAGTAATGCCCGTGATAATTGGCGGATTTGGAAATTGACTAGTACCCCTT
    ATGATCGGGGCCCCCGATATGGCATTCCCCCGGATGAATAACATAAGCTTCTGGCTCCTA
    CCGCCCTCATTTCTTTTATTATTGGCCTCCTCAGGTGTGGAGGCAGGAGCAGGGACCGGA
    TGAACCGTCTATCCCCCCTTGGCGGGTAATCTCGCCCATGCGGGCGCCTCTGTTGATTTA
    ACAATCTTTTCCCTGCATCTAGCCGGGGTCTCCTCTATTCTAGGGGCAATCAATTTTATT
    ACAACCTCAATTAATATAAAACCCCCTTCCATAACACAATACCAAACACCCCTGTTTGTA
    TGGTCGGTGTTGATTACGGCTATTCTTCTACTTCTTTCTCTCCCAGTGCTTGCAGCTGGT
    ATTACAATGCTATTAACCGACCGAAACCTCAATACTACTTTTTTTGACCCGGCTGGTGGA
    GGAGACCCCGTGCTATATCAACATCTG

    Taxonomy

    Phylum: Chordata
    Class: Amphibia
    Order: Caudata
    Family: Salamandridae
    Subfamily: Pleurodelinae
    Genus: Pachytriton
    Species: Pachytriton labiatus


    BOLD Specimen Record URL
    BOLD BIN Page URL