COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ13773

    Species Name: unknown
    Species Code: XXXXXXX
    Specimen AccNo: MJ13773
    Locality: Varirata N.P.
    Elevation: 765
    Date: 10. 11. 2010
    Method: HC
    Habitat: forest
    Collector: M. Janda, T. Pius
    Nest: dead branch on tree

    DNA

    Sequence COI-5P

    Process ID: DYNA066-16
    Sequence ID: 8462350
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession: Pending (#6518)
    Nucleotides:
    --AACTTTATATTTTATTTTTGGTGCTTGGGCGGGAGCTGTAGGTACAGCTCTCAGTATA
    ATTATTCGCACGGAATTGGGTCAAGCAGGCAGGTTTATTGGAGATGATCAGATTTATAAT
    GTGGTAGTCACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTCATGCCTGTGATGATC
    GGAGGATTTGGGAATTGGTTAGTTCCTCTTATGTTGGGTGCTCCTGATATGGCTTTCCCC
    CGTATAAATAATATAAGCTTTTGACTCCTGCCTCCAGCTCTTTTACTTCTGCTCAGAAGA
    GGGTTAGTGGAGAGAGGAGTGGGGACAGGGTGAACAGTTTATCCTCCCCTTGCTGGAAGG
    GTAGCACACAGTGGGCCCTCTGTCGATCTTGGTATTTTTTCTCTTCATCTAGCGGGTGCT
    TCATCCATTTTGGGGGCTATTAATTTTATTTCTACTACCATTAACATACGAGCGGCAGGG
    ATAAGAATGAGACGAATCTCATTATTCGTGTGATCTGTCCTTATTACGGCAGTTTTGCTC
    CTCCTCTCGCTCCCTGTCCTAGCGGGCGCTATTACCATGCTTTTAACAGACCGGAATTTA
    AATACTTCTTTTTTTGATCCTAGAGGGGGAGGAGATCCTATCTTATACCAGCATTTATTT

    Taxonomy

    Phylum: Arthropoda
    Class: Malacostraca
    Order: Isopoda
    Family: Sphaeromatidae
    Genus: Dynamene
    Species: Dynamene edwardsi


    BOLD Specimen Record URL
    BOLD BIN Page URL