COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ13903

    Species Name: WEAM05
    Species Code: POLY125
    Specimen AccNo: MJ13903
    Locality: Weam forest
    Elevation: 13
    Date: 15. 10. 2010
    Method: WE
    Habitat: rainforest
    Collector: M. Janda, T. Pius
    Nest: undefined

    DNA

    Sequence 28S

    Process ID: DYNA066-16
    Sequence ID: 8908153
    Last Updated:
    Marker Code: 28S
    GenBank Accession: MK505916
    Nucleotides:
    ACCCACAGGCAGGGGAACGGGCCTGCGTGACGTTGCGGGGAAAGAAGACCCTGTTGAGCT
    TGACTCTAAGTTGATATTGTGGAGAGACATGAGAGGTGTAGCATAAGTGGGAGGATCGGG
    TCCGGAGTTAAGTTAGCGTTCCGTTGGCGTAGCTCTTTCCGAGCCAACAATGAAATACCA
    CTACTGTCATCGTTTCTCCACTAACCCGGTGAAGCGGACAAAAGACCCCGTCTTTCGGCC
    TATCTTTCTCAGCTCTTTCCTTTCGAGGCGGGGCGGATCGTAGTCGTCGTGGTCGGGTGT
    CTAGCGTTCTAGCGTCAAGCATTGGTCTTTTTTTATCCTTCCGTTTTCGGTTGCGTTCTC
    GCTTGCGTTCAACTCGCTGGTAGGTATATCACCTCCTGCGTGCGTGGAGCTCGCGAATTC
    GCGCTAAAGTCGAATATAAGCGGTGCTGGACGAAAGAGTTCACGATCAATGCGAGCCGAA
    CCGGGGACACTGTCAGCCGGGGAGTTTGACTGGGGCGGTACATTTGCCAAACGATAACGC
    AGGTGTCCCAAGGTCAGCTCAGAGAGGACAGAAACCTCTCGTTGAGCAAAAGGGTAAAAG
    CTGACTTGATCTGTATTTTCAGTATGAATACGGACTGCGAAAGCAGGGCCTATCGATCCT
    TTTGATTTCTCTAGAGTTTAGAGTAAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGG
    CTTGTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTC
    CTATCATTGCGCGGCAGAATA-

    Taxonomy

    Phylum: Arthropoda
    Class: Malacostraca
    Order: Isopoda
    Family: Sphaeromatidae
    Genus: Dynamene
    Species: Dynamene edwardsi


    BOLD Specimen Record URL
    BOLD BIN Page URL