COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ7856

    Species Name: sp. 2
    Species Code: PSEU002
    Specimen AccNo: MJ7856
    Locality: Baitabag
    Elevation: 50-100
    Date: 10. 1. 2010
    Method: HC
    Habitat: primary lowland forest - photo
    Collector: Janda&Ibalim
    Nest: same nest as 76- inside dry folded leaf, 0,3m above ground

    DNA

    Sequence 18S-V4

    Process ID: DYNA067-16
    Sequence ID: 8908058
    Last Updated:
    Marker Code: 18S-V4
    GenBank Accession: MK505997
    Nucleotides:
    GGCTCTGGGAGGTAGTGACGATAAATAACGATGCGGGACTCATCCGAGGCCTCGCAATCG
    GAATGAGATCAGTCTAAAACTTTGGACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGC
    AGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGT
    AGTTTGACTTTAGACTCGTACCGGGGGCCCACCCAAGGAGAGTACCTCGCGGAGACCTCT
    TTACGCGTTTGTGGCATTCCGGTTGGTCGATGACGGAATAAGTTGACGGTGCGCGCTTGA
    AACTCTCCCCTTGTCGCTTGGATTACGACGATGTTCGATCGCTAAGTATTTAAGTATACG
    GCTCGAGCATCTCGCTTTTCCTAAGTATGGGGTGTAGCGACTCGCGTCGAATCTCGACCT
    CCGTTCACGCGCCTTCCGAATTTGCCCCTTCGCTCGAGCTGCTTACGAGTTTCGCTTTCC
    CGGTGGCAACCCGCTCGGATACGGGTTTTTAACAAACCCGTCGGTTCTCGCGGGGTGCTC
    TTTACCGAGTGTCTCGCGTGGCTGGCAACGTTCACTTTGAAAAAATTAGAGTGCTCAAAG
    CAGGCAAAAATCTATGCCTGAATGTATATGCTTAGGATGAAGGAACAGGACCTCGGTTCT
    GCAATTATTTTTCTCTCGGTTTTTCCCGAACCCGAGGTAATGATTAACCGGGGCGGACGG
    GGGCATTGGTATTGCGGCGCGAGAGGTGAAATTCTAAGACCGTCGCAAGACTACCTACTG
    CGAAAGCATTTGCCAAGAACGCTTTCATTAATCAAGAACGAAAGTTAGAGGATCGAAGGC
    GATCAGATACCGCCCTAGTTCTAACCTTAAACGATGCCAACTAGCGATCCGCCTAAGTCA
    TTCCCACGACTGGGCGGGCAGCCCCCGGGAAACCAAAGTTTTTGGGTTCCGGGGGAAGTA
    TGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTG
    CGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGCCCGGACACCGGAAGGATTGACA
    GATT

    Taxonomy

    Phylum: Arthropoda
    Class: Malacostraca
    Order: Isopoda
    Family: Sphaeromatidae
    Genus: Dynamene
    Species: Dynamene edwardsi


    BOLD Specimen Record URL
    BOLD BIN Page URL