COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ7886

    Species Name: WEAM03
    Species Code: POLY118
    Specimen AccNo: MJ7886
    Locality: Kaiangabip
    Elevation: 180-280
    Date: 10. 1. 2010
    Method: HC
    Habitat: primary lowland forest - photo
    Collector: Janda&Ibalim
    Nest: undefined

    DNA

    Sequence rbcL

    Process ID: GBVA5175-21
    Sequence ID: 14716793
    Last Updated:
    Marker Code: rbcL
    GenBank Accession: MH049963
    Nucleotides:
    CAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATT
    ATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTC
    AACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTA
    CATGGACAACTGTATGGACCGATGGACTTACGAGCCTTGATCGTTACAAAGGCCGATGCT
    ATGGACTTGAGCCTGTTCCTGGAGAAGACAATCAATATATTGCTTATGTAGCTTACCCAC
    TAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTAT
    TTGGGTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCGACTGCATATG
    TTAAAACTTTCGAGGGTCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGT
    ATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACT
    ACGGTAGAGCTTGTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGA
    ACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTA
    TTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTG

    Taxonomy

    Phylum: Magnoliophyta
    Class: Magnoliopsida
    Order: Asterales
    Family: Asteraceae
    Subfamily: Asteroideae
    Genus: Xanthium
    Species: Xanthium strumarium var. canadense


    BOLD Specimen Record URL
    BOLD BIN Page URL