COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ8744

    Species Name: sp.2
    Species Code: ACRO002
    Specimen AccNo: MJ8744
    Locality: Kaiangabip
    Elevation: 180-280
    Date: 21. 3. 2008
    Method: WE
    Habitat: primary lowland forest - photo
    Collector: Janda&Ibalim
    Nest: undefined

    DNA

    Sequence COI-5P

    Process ID: CLACE279-22
    Sequence ID: 15785238
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession:
    Nucleotides:
    TCGCGACAATGATTATTTTCAACTAACCATAAGGATATTGGTACTTTATATTTTATTTTC
    GGAATTTGATCTGGATTAGTAGGTACAAGATTAAGTTTATTGATTCGAGCTGAATTAGGT
    CAACCAGGTTCTTTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCACATGCT
    TTTATTATAATTTTTTTTATAGTAATACCTATTGTAATTGGAGGTTTTGGTAATTGATTA
    GTTCCTTTAATATTAGCTGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTC
    TGAATATTACCTCCTTCATTAACTTTATTACTTGCTTCTTCTATAGTAGAAAGAGGAGCT
    GGAACTGGTTGAACAGTTTACCCTCCTTTATCATCAAGAATTGCACATGCTGGAGCTTCT
    GTTGATTTAGCTATTTTTAGTTTACATCTTGCCGGTATTTCATCAATTTTAGGAGCAGTA
    AATTTCATTACAACAGTAATTAATATACGATTAAGTTATATAACATTAGATCGTATACCA
    TTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTATTACTTTCATTACCTGTATTA
    GCTGGTGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCT
    GCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGA---------

    Taxonomy

    Phylum: Arthropoda
    Class: Insecta
    Order: Neuroptera
    Family: Chrysopidae
    Subfamily: Chrysopinae
    Genus: Chrysoperla
    Species: Chrysoperla nipponensis


    BOLD Specimen Record URL
    BOLD BIN Page URL