COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ9159

    Species Name: graeffei
    Species Code: ANOCX05
    Specimen AccNo: MJ9159
    Locality: Weam site_1
    Elevation: 19
    Date: 16. 10. 2010
    Method: HC
    Habitat: savannah
    Collector: M. Janda, T. Pius
    Nest: Nest in soil under wood

    DNA

    Sequence COI-5P

    Process ID: CLACE279-22
    Sequence ID: 15785238
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession:
    Nucleotides:
    TCGCGACAATGATTATTTTCAACTAACCATAAGGATATTGGTACTTTATATTTTATTTTC
    GGAATTTGATCTGGATTAGTAGGTACAAGATTAAGTTTATTGATTCGAGCTGAATTAGGT
    CAACCAGGTTCTTTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCACATGCT
    TTTATTATAATTTTTTTTATAGTAATACCTATTGTAATTGGAGGTTTTGGTAATTGATTA
    GTTCCTTTAATATTAGCTGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTC
    TGAATATTACCTCCTTCATTAACTTTATTACTTGCTTCTTCTATAGTAGAAAGAGGAGCT
    GGAACTGGTTGAACAGTTTACCCTCCTTTATCATCAAGAATTGCACATGCTGGAGCTTCT
    GTTGATTTAGCTATTTTTAGTTTACATCTTGCCGGTATTTCATCAATTTTAGGAGCAGTA
    AATTTCATTACAACAGTAATTAATATACGATTAAGTTATATAACATTAGATCGTATACCA
    TTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTATTACTTTCATTACCTGTATTA
    GCTGGTGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCT
    GCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGA---------

    Taxonomy

    Phylum: Arthropoda
    Class: Insecta
    Order: Neuroptera
    Family: Chrysopidae
    Subfamily: Chrysopinae
    Genus: Chrysoperla
    Species: Chrysoperla nipponensis


    BOLD Specimen Record URL
    BOLD BIN Page URL