COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ13624

    Species Name: dahlii
    Species Code: POLYX42
    Specimen AccNo: MJ13624
    Locality: Dorogori savannah
    Elevation: 14
    Date: 1. 1. 1970
    Method: HC
    Habitat: savannah
    Collector: M. Janda, T. Pius
    Nest: carton nest on leaf

    DNA

    Sequence COI-5P

    Process ID: GBMAB814-15
    Sequence ID: 7748359
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession: KP793137
    Nucleotides:
    TTTCTTTTAGGGGTGTGATCGGGAATAATTGGGACTGCTATGAGGGTTTTAATTCGGGTA
    GAGCTTGGACAACCTGGATCATTTCTTGGTAATGAGCAGCTTTATAACTCTATTGTGACG
    GCTCATGCCTTTCTAATAATTTTTTTTTTAGTAATGCCTGTTATAATTGGGGGCTTTGGT
    AATTGGCTTTTACCTTTGATATTGAATGTTCCAGATATGGCATTTCCTCGTTTAAATAAT
    TTAAGGTTTTGGTTGTTACCTCCTGCTTTATTATTATTATTATTATCTGCGCTTGTAGAA
    AAAGGGGCAGGAACAGGTTGGACTGTTTATCCTCCTTTGTCTGGGAATCTAGCACATGCT
    GGGGGTTCGGTGGATTTAGCGATTTTTTCTCTTCATCTTGCTGGGGCTTCTTCAATCTTA
    GGGTCATTAAATTTTATTACTACCATTATTAACACTCGAAGTTGGGGTATAAGGTTAGAG
    CGGATACCGTTGTTTATTTGGGCGGTTAAGATTACTACCATTTTATTGTTATTGTCATTG
    CCAGTATTAGCTGGAGCTATTACTATATTGCTGACTGACCGGAATATTAATACGGCATTT
    TTTGACCCGG

    Taxonomy

    Phylum: Annelida
    Class: Polychaeta
    Order: Sabellida
    Family: Sabellidae
    Subfamily: Sabellinae
    Genus: Laonome
    Species: Laonome sp.


    BOLD Specimen Record URL
    BOLD BIN Page URL