COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ9372

    Species Name: sp.6
    Species Code: IRID006
    Specimen AccNo: MJ9372
    Locality: Arufi
    Elevation: 3
    Date: 10. 10. 2010
    Method: HC
    Habitat: savannah by village
    Collector: M. Janda, T. Pius
    Nest: undefined

    DNA

    Sequence COI-5P

    Process ID: DSFIB836-18
    Sequence ID: 10265498
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession:
    Nucleotides:
    CACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGCACAGCTCTAAGCCTACT
    CATTCGAGCGGAGCTAAGCCAACCCGGCGCCCTCCTGGGGGACGACCAAATTTACAATGT
    CCTTGTTACAGCGCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGG
    GGGTTTTGGAAACTGGCTCGTACCCTTAATAATTGGGGCCCCGGACATGGCATTCCCCCG
    AATAAACAACATGAGCTTTTGACTCCTTCCCCCATCTTTTCTTCTCCTCCTTGCCTCTTC
    GGGGGTAGAGGCGGGTGCTGGGACAGGATGAACAATTTACCCCCCTCTCTCTGGTAACTT
    AGCCCATGCAGGAGCCTCCGTTGATTTGACAATCTTCTCCCTCCACCTAGCAGGGATCTC
    TTCAATCCTCGGGGCAATTAATTTTATTACGACCATCATTAACATGAAGCCTCCTGCGAT
    CTCTCAGTACCAGACACCCCTCTTCGTCTGGTCCGTGCTCATTACAGCGGTCCTACTTCT
    CCTCTCTCTCCCCGTCCTTGCAGCTGGAATTACCATGCTCCTGACAGATCGTAACCTTAA
    TACCACCTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTCTATCAACACCTGTTC

    Taxonomy

    Phylum: Chordata
    Class: Actinopterygii
    Order: Scorpaeniformes
    Family: Zoarcidae
    Subfamily: Lycodinae
    Genus: Lycodes
    Species: Lycodes luetkeni


    BOLD Specimen Record URL
    BOLD BIN Page URL