COMPARE BASKET
0 specimen

    Drag&drop here specimen or species from table.

    SPECIES DIRECTORY
    Double Click to jump
    Compare basket

    Specimen MJ13786

    Species Name: PM06
    Species Code: POLY116
    Specimen AccNo: MJ13786
    Locality: Varirata N.P.
    Elevation: 765
    Date: 10. 11. 2010
    Method: HC
    Habitat: forest edge
    Collector: M. Janda, T. Pius
    Nest: forage tree, outlook

    DNA

    Sequence COI-5P

    Process ID: GBMAB814-15
    Sequence ID: 7748359
    Last Updated:
    Marker Code: COI-5P
    GenBank Accession: KP793137
    Nucleotides:
    TTTCTTTTAGGGGTGTGATCGGGAATAATTGGGACTGCTATGAGGGTTTTAATTCGGGTA
    GAGCTTGGACAACCTGGATCATTTCTTGGTAATGAGCAGCTTTATAACTCTATTGTGACG
    GCTCATGCCTTTCTAATAATTTTTTTTTTAGTAATGCCTGTTATAATTGGGGGCTTTGGT
    AATTGGCTTTTACCTTTGATATTGAATGTTCCAGATATGGCATTTCCTCGTTTAAATAAT
    TTAAGGTTTTGGTTGTTACCTCCTGCTTTATTATTATTATTATTATCTGCGCTTGTAGAA
    AAAGGGGCAGGAACAGGTTGGACTGTTTATCCTCCTTTGTCTGGGAATCTAGCACATGCT
    GGGGGTTCGGTGGATTTAGCGATTTTTTCTCTTCATCTTGCTGGGGCTTCTTCAATCTTA
    GGGTCATTAAATTTTATTACTACCATTATTAACACTCGAAGTTGGGGTATAAGGTTAGAG
    CGGATACCGTTGTTTATTTGGGCGGTTAAGATTACTACCATTTTATTGTTATTGTCATTG
    CCAGTATTAGCTGGAGCTATTACTATATTGCTGACTGACCGGAATATTAATACGGCATTT
    TTTGACCCGG

    Taxonomy

    Phylum: Annelida
    Class: Polychaeta
    Order: Sabellida
    Family: Sabellidae
    Subfamily: Sabellinae
    Genus: Laonome
    Species: Laonome sp.


    BOLD Specimen Record URL
    BOLD BIN Page URL